--====================987654321_0==_
Content-Type: text/plain; charset="us-ascii"



>Well it was a good little fic and the first time I read it I was in 
shock.
>I had never come across such a creative and well-written idea (a bit
>twisted but hey, aren't we all?). It seems to compliment the page quite 
well.
>
>>I have to wonder, have you ever read "Father Figure" By Tzigane?  Or
>
>No, if you could send me a copy I'd appreciate it. ^_^
>

     Okay, sorry to take so long getting back to you... here's the 
story, from what I understand, Tzigane worked on the first draft for 
this story before I even thought of Real Reasons, but I was the first 
person of anyone to post a story of this type (That we know of) 
Enjoy!

Ridgewolfe



     "let me tell you something, the whole world is a circus, if you 
know how to look at it.  The way that the sun goes down when you're 
tired, comes up when you want to be on the move... that's real magic.  
The way a leaf grows... the song of the birds... the way the dessert 
looks at night, with the moon embracing it... oh my boy... 
That's--that's circus enough for anyone.  Every time you watch a rainbow 
and feel wonder in your heart... every time you pick up a handful of 
dust, and see not the dust, but a *Mystery*... a marvel there in your 
hand... every time you stop and think `I'm alive, and being alive is 
fantastic'... every time such a thing happens, your a part of the circus 
of Dr. Lao."   
     quote from "the Seven faces of Dr. Lao"


______________________________________________________
Get Your Private, Free Email at http://www.hotmail.com
--====================987654321_0==_
Content-Type: text/plain; name="FATHRFIG.txt"
Content-Disposition: attachment; filename="FATHRFIG.txt"



Even most totally straight ppl have enjoyed these. I liked writing 'em.
There's some violence in this one.. the first story.... and some in the
third, too, I dunno... No, I don't deal with P-chan.. Hope you like... :)

                               -=*Father Figure*=-

"I will be your father figure/Put your tiny hand in mine/ I will be your
        preacher, teacher/Anything you have in mind. "
                                        -- George Michael, "Father Figure"

                *****************************************

        "You've been havin' it way too easy lately, Ranma m'boy. "

        The words reverberated in the young man's mind relentlessly,
hardening his jaw as he listened to the adults blather on about "training"
and how important it was and yatayatayata.

        "So quit talkin' and start trainin'," he murmured resentfully,
crossing his arms over his chest. He heard Happosai blathering on about
something and only halfway listened to the rest of the conversation. It was
at that moment that his father's words hit him like a brick.

        "I think you're in need of some re-education, boy. "

                                ******************

        The first time Ranma had heard those words, he had been thirteen.
It had been years since he'd seen his mother and he was having an
extraordinarily BAD day. Between the girl riding the large pig that had
stomped it's way right over him and the girl with green hair that had
*zapped* him as she flew past chasing some boy with brown hair, it just
wasn't Ranma's day.[1]

        And it was about to get worse.

        Genma was lazing about near the campfire (already a little too
close to drunk on the sake to make Ranma comfortable) and glaring at Ranma
through the flames. Ranma had seen that glare before, usually before his
father's temper blew up at him, and thus he was being especially careful
not to do anything to rouse the large man's ire.

        Not that Genma really needed anything, of course. He'd find
something, shortly. One way or another.

        "Who was that boy I saw you walking with the two days ago, Ranma?"
came the unexpected question.

        Ranma's sapphire eyes flew open wide as his head shot up. "What
boy, Pop?" he asked in confusion.

        "The one with the bandanna. The one that looked like he was going
to reach out and hold your hand, *BOY*."

        Ranma gulped. There were a lot of things in his life that he truly
didn't want his father knowing anything about, and Ryouga was one of them.
At first, the whole thing had been a game. Steal the bread, see who wins,
winner takes all sort of thing. Then it had become excitement in the pit of
his belly and then shame at what he was thinking -- until Ryouga had
frightenedly confessed that he'd been having the same thoughts as well as
they walked home one afternoon. Ranma spent a great deal of time guiding
Ryouga about as a result...he couldn't seem to find much of anywhere on his
own. Ranma knew that the risk of being caught by Oyaji was pretty much
fifty-fifty, but he thought that what he had with Ryouga was worth it.[2]

        Ranma raised an eyebrow, trying to look nonchalant. "Just some guy,
Pop. We spar a lot, y'know...after school and stuff. "

        Ranma had thought that his excuse might be the one to back off his
father's coming anger, but it only served to stiffen the older man's back,
his scowl well-fixed as he rose, hand reaching to the side of him. "Letting
someone subvert my training, boy? How many times do I have to tell you that
a martial artist listens and learns from *all*, not just from one?
Especially not some boy like _that_ one, " he seethed in disgust. "Some boy
who looks like he's going to touch you as you walk down the street... yaoi
fucker...."

        Ranma paled. He knew the rhythm in these things and he just wasn't
big enough yet to protect himself against what would come next.

        Ranma stood clumsily, stumbling a bit across a rock that was placed
near the circle of stones that made the fire ring. Genma was rising, coming
closer, and in his hand was something that Ranma recognized from his
earliest years on the road with his father, something that made him stiff
with fear and limp with acceptance all at the same time.

        "You know the position, boy. Assume it. "

        Ranma carefully drew the red satin shirt he'd changed into after
school over his head, folding it with smooth, precise motions. With only a
second's hesitation, he pulled off his pants as well, more jerkily than he
had his shirt, the sheer humiliation of the act making him tremble, tears
not far away.

        He heard Genma chuckle angrily and saw him shake his head as he
began to turn. "Oh, no. No, no, Ranma, m'boy. The rest of it, as well.  I
think you're in need of some re-education, boy."[3]

        Ranma's entire body went still as he stared at his father with wide
eyes, shivering in the cool night air. "Wh..what? " he stuttered softly,
disbelieving as he bit his lip tightly to keep it from trembling.

        "You heard me, boy. Off with the shorts. "

        Ranma bowed his head, fighting somewhere inside of himself as his
very soul began to shake. His fingers quivering, Ranma hooked his thumbs in
the waistband of his boxers and pulled, tugging them down over lithe hips
and folding them with his pants and shirts before he turned his back to his
father slowly. He felt it then -- the leather strap flying from his
father's hand and wrapping around a hip to burn a welt into his tummy, just
below his navel. Ranma grunted with pain and dropped to his knees, eyes
dewed over with tears as he reached up, right hand flashing open, left hand
grasping the right wrist in a fist as he leaned forward, forehead placed
against the cool grass.

        Genma grunted harshly, a foot coming between his son's knees to
push them apart further, leaving certain muscles tight and offering him a
view of everything the boy had. After raising an eyebrow and eyeing the boy
contemplatively, it commenced.

        Ranma moaned softly every so often. He could feel the welts marking
him, the belt licking across the small of his back, his inner thighs, as
high as his shoulders. He could feel his body writhing beneath the blows
and he knew that If it went on for much longer he would embarrass himself,
faint or wet the grass beneath him or vomit with the fear and the pain. It
couldn't go on much longer. Surely it couldn't, or he'd pass out....

        It was then that he heard the belt hit the grass and heard the soft
rustle of cloth.

        Ranma's fingers slowly began to unclench, stiff from holding his
wrist so tightly...and then he felt Genma behind him, pulling him closer,
and he felt something oddly familiar pressed to the back of his thigh. His
body went still as he cried out and began to struggle valiantly, but to no
avail. What had been an act of tenderness with Ryouga became an act of
shame, his back bowing as he cried out in pain and disbelief, tears
streaming down his face as he felt the heavy thickness of the penetration,
the deep pain of a part of his soul being destroyed. Ranma knew that the
easiest thing to do would be to faint, to pass out and to forget. He also
knew that he would never be able to block it out totally and thus it would
be pointless.

*******

        It was over, done with. Ranma shuddered beneath the light material
of his sleeping bag, his body bare and aching as he sighed with
resignation, suppressed sobs rippling through him as he shook violently,
only daring every now and then to glance across at the snoring heap on the
other side of the fire that was his father. With feather light fingers, he
reached behind him and rubbed one of the welts, tears gathering again as
the pain echoed across his skin.

        Ryouga should have been here two days ago. Ranma knew that it was a
mistake to let him run home by himself instead of just coming here and
getting his things and leaving then, but he thought that it would be all
right, that his father would remain calm and sober long enough for Ryouga
to actually make his way back to this empty lot.

        It was a foolish hope. Ranma knew that, now. With a rough hand, he
brushed away the tears still streaming down his face. Tomorrow. They were
leaving tomorrow. Maybe Ryouga would be here by then. Maybe there was still
the chance to leave....

        And with that thought, the exhausted young warrior known as Ranma
Saotome tumbled over the edge of his enervation and into a deep, dreamless
-- and, hopefully, healing -- sleep.

                                ******************

        Ranma trounced Happosai angrily, balancing on top of the little old
pervert. His anger at the remnants of that memory echoed in every bit of
his flesh as he glanced up at his father, looking pensive.

        "Of course, Tendo, each martial artist has his own special way of
training," Soun murmured.

        "If it ain't broke, don't fix it, I always say," Genma responded
solemnly as the two turned in concert and headed back for the house.

        Ranma heaved Happosai over his shoulder to carry him back to the
house, a miserably unhappy look reflected on his face. Finally, he was old
enough to protect himself. Things like that didn't happen anymore and Oyaji
had forgotten that it ever had. Oyaji was mostly sober, these days, and
rarely got mean -- perhaps it was the panda coming out in him.

        And now he had to deal with Ryouga hating him for not being there
when he needed him.

        "Well, old buddy, " Ranma muttered to himself, "it ain't like you
were there for me, either. " With that pronouncement, Ranma walked in the
back door and back into chaos.

                      *********************************

        [1] I know. The time sequence is probably a little out, but just
work with me. It's an alterniverse, for star's sake...
        [2] Charmingly oblique, wouldn't you say? So I'll just go ahead and
say it, outright -- yeah, Ranma and Ryouga are lovers (for what it's
worth). If you don't like it, don't read it. Trust me when I say that (in
this particular world) both boys need someone who cares for them a great
deal -- Ranma, because of his father's particular disposition, Ryouga
because of the loneliness that one would accrue, living in a household in
which no-one ever managed to find their way home.
        [3] I know. I KNOW that it sounds sort of corny. But doesn't it
sound sort of.. right, as well?

        I promised an explanation of this, didn't I? All right, then. I
stand by this story, regardless of flames or complaints. I _do_ _not_
_apologize_ for it. We've had a lot of back and forth recently about
everything from non-consent to yaoi to the frightening and hideous
potential of Genma and sex....and the more I thought about it, the more
tempted I was. You should never tell me what I "cannot" do, because I love
to do just that. ^_~  The possibilities were endless, there were so MANY
things that could turn people on their ears.... Of course, even *I* wasn't
going to touch the watersports bit, anyway... Kun-chan's inimitable  "Ranma
no Hentai" was beautiful, and I thought, well.. all right, I can give a
shot at SOMETHING like that, surely. Perhaps it won't be so beautifully
done...but I guess they can put up with it. (No, this is not an 'I can beat
that/top that/make it worse than that' fic, thank you much.)(Obviously --
Kun-chan does exquisite work, and this is rather darker than anything I've
ever seen her do.)

        At any rate. I was watching "Bathhouse Battle" the other day and
that line just sort of stuck. *You're in need of some re-education, boy.*
Genma never sounds like a loving parent to me, anyway, but that PARTICULAR
phrase made me shudder. From there, the idea ran like wildfire and so I had
a talk with one of my college roommates who's working in a psych. hospital.
This is a likely scenario -- much more likely than, say, the one in "A Real
Man" in which Genma takes his young son to visit....er... ladies of ill
repute. As much as one really *doesn't* like the idea...There you have it.
I figure that there are a lot of people out there who are going to flame me
wildly one way or another, anyway. *shrug* I warned you. It was labeled. I
even TOLD you what it was. If you didn't pay attention to it, don't flame
me. I WARNED you. More will follow, and it will be "better", (i.e., consent
given -- I prefer it that way, but this needed to be gotten off of my chest
rather badly), still some yaoi, maybe some bdsm and a little voyeurism. If
you didn't like this, perhaps you'll like the next one -- or the one after
that.

        Thanks go to Shuichi for the inspiration and for taking the time to
read for me. The particular "form" that Ranma assumes comes from a story in
_Flesh & the Word 3_ (edited by John Preston). I can't recall the name of
the story, but it had a certain quality to it that's difficult to put into
words. Alluring would be the most apt of terms. Nothing like this, of
course, but quite charming all the same.

tz
        ***************************************************
        *  If I die let it be with you...                 *
        *  Hold me close while the world falls in on me.. *
        *  Whisper my name as the darkness rises...       *
        *  And I fall into the dream that never ends...   *
        *      From:"The Scarlet Letters" by Scott Urban  *
        ***************************************************
 

                                -=*Blood & Fire*=-

        "I always thought we'd be together/And that our love could not be
        better/Well with no warning you were gone/I still don't know what
        went wrong/You don't know what I've been through/Just want to put
        my love in you/No more nights/Of blood and fire..."
                                -- Type O Negative, "Blood & Fire"

        ***********************************************************

        If a pedestrian had been walking in the region of the old bridge
that afternoon, they might have thought that the sun was trying to rise
from beneath it. The glow that came from below pulsed, resembling a strobe
light -- and then the blasts began to hit.

        Ryouga growled fiercely, his shishi houkodan missing Ranma by
inches as it exploded near his feet, knocking Ranma back against one of the
bridge supports. "Get back here, Saotome!! Because of you, I'VE SEEN
HELL!!!" With that battle cry, Ryouga moved forward in a rush with his fist
pulled back and gave a hard punch.

        Ranma jerked his head to the side, feeling the wind of Ryouga's
movement flying past his face as he gave several hundred of his own.
"Katchu tenshin amiguriken!!!" he cried aloud, slamming both fists
repeatedly into Ryouga's gut before he jumped and rolled to stand on a
nearby culvert, left beneath the bridge by a lazy construction crew.

        Ryouga grunted and rubbed his stomach for a rare second and then
turned, fury lighting behind his eyes. "I've followed you for months!! For
*YEARS*, now, through country after country, through Jusenkyo....." Ryouga
growled even more loudly. "EVERYTHING THAT'S WRONG WITH MY LIFE IS YOUR
FAULT, RANMA!!! " With that, he came rushing towards Ranma's precarious
position atop the concrete divider.

        Ranma had heard it all before, many times. It seemed to be Ryouga's
favorite battle cry, and he did it so *well*, too. Unfortunately for
Ryouga, Ranma had recently been reminded of a part of his past that he had
managed to keep buried for years. Today was *not* a good day to accuse
Ranma of making anyone's life "hell".

        "RRRRRRRRRRRRYYYYYYYYYYOOOOOOOOUUUUUUUUUGGGGGGAAAAAAA!!!!!!" Ranma
shouted furiously before pulling back and, out of the blue, delivering a
barroom roundhouse that knocked Ryouga flat on his back, holding his jaw
and looking up at Ranma in astonishment.

        "Whhaa...?"

        Ranma's blue eyes shimmered with anger and restrained tears, his
hands trembling violently as he balled them into fists. "*I* made *your*
life hell, Ryouga? Who showed up four days late, huh? Who was it that's so
damned "directionally challenged" that he couldn't make a fifteen minute
walk in three days? Didja ever think maybe I didn't have any CHOICE about
leavin'!?!" Ranma swerved around, his back to Ryouga, arms tensed. "Who
keeps sayin' it wasn't nothin' but a duel over BREAD? Hmmmm?"

        Ryouga had the good grace as to look slightly shame-faced as he
stood, tilting his head to the side and looking at Ranma's back, the line
of his waist and hips and thighs with a nervous swallow. "Well, that's all
it was, right? Some little game, some experiment?"

        Ranma reacted violently, turning and moving so quickly Ryouga
almost missed him until Ranma had him by his shirt, pulling him forward
tightly. "A GAME!?! You call what we were A GAME!?! Do you.. have any..."
Ranma stopped, breathing quickly and looking so wild that Ryouga's
instincts were screaming at him to run, get away, DO something about this
ferocious madman that had hold of him. Ranma loosened his grip and stepped
back, his voice raw and grating as if it was all he could do to continue,
"Ryouga, do ya know what you left me to? Huh?" His eyes filled with unshed
tears again as he thrust a hand through his bangs roughly, growling in
anguish as the memories flooded him. "Oyaji SAW us, Ryouga. That day in the
park when we were playin' around, y'know, and you reached for my hand while
I was walkin' you home." Ranma lifted his chin and his eyes, glacial now as
he recounted the old story. "It wasn't just a beatin' that time, Ryouga."

        Ryouga put a hand to his stomach, feeling nauseous as he paled,
turning ghost white. His fingers trembled as he reached out to touch
Ranma's shoulder, moth wing soft and trembling. "You don't mean... I mean,
he didn't..."

        Ranma jerked his shoulder away savagely and hissed, "Don't touch
me! Just don't fuckin' touch me!" With that, he jumped up the side of the
ditch, propelled himself to the rooftops and ran.

        Ryouga slumped to the ground, buried his face in his hands...

        ...and cried.

        ********************************************************

        Ranma shut the window after him as he crawled in from the rooftop,
laying down on his futon with an exhausted sigh. His entire body seemed to
ache from holding everything in so tightly, his hands were trembling and
his stomach was tied in knots.

        He could hear Akane and Nabiki outside, sunbathing next to the pond
and singing along with the radio. A slight smile spread over his face as he
thought about Akane. He really _did_ think that he might love her. If she
would show the slightest sign of accepting him and really mean it, he'd
jump in a minute, or so he sometimes thought.

        She could be so cute sometimes. When she smiled, it was like water
to a man dying of thirst, like the sun coming out from an embankment of
clouds. Just remembering the way she had looked at him not a week ago, the
way he had almost been fooled before the tape went over his mouth and she
kissed _it_ instead of him....his knees went weak thinking about it. If she
had really kissed him, he'd probably have turned into a limp puddle of
flesh and fainted dead away from the shock of it, he thought ruefully.
{Yeah,} he thought, {guess I really do l..l.. have feelings for the tomboy
iinazuke of mine.} He gave a little smile that quickly faded when he
thought of Ryouga.

        What had happened three years ago was something that they had never
really talked about. Ranma had accepted it at face value and made
assumptions about Ryouga's own feelings. That was a mistake that he
obviously shouldn't make again. Ranma bit his lip and thought once again of
that lost afternoon in Ryouga's arms, the grass in that unknown field
weaving magic as Ryouga bit gently with those little fangs that Ranma had
always been slightly envious of for some reason. The feelings that he had
for Ryouga and Akane were so similar that he didn't know what he should do
about them.

        Genma popped his head in the door and raised an eyebrow at Ranma.
"You're lazy, boy. You should be practicing! Martial arts isn't just
something for weekends, you know..."

        Ranma threw a convenient glass of water towards the doorway,
hearing it shut rapidly -- but not quickly enough. He could hear Oyaji
shuffling off in panda form after a heaving sort of panda sigh. {Poor Pop,}
Ranma thought dryly. He rolled his eyes before turning on his stomach and
pressing his face into his pillow to silence the semi-silent catches of
breath that finally lulled him into sleep.

        *******************************************************

        He was slow to wake, slower to actually function. He could feel the
tracks of tears on his face and was disgusted with himself for crying in
this form. His hands brushed his cheeks to get rid of the feeling as he
looked out into evening. The sun had gone hours before and the only thing
that he could hear from downstairs were snores from Soun and Genma.
{They've prob'ly been hittin' the sake tonight,} Ranma thought with a
shrug. Didn't really matter to him -- he could protect himself from drunken
assaults these days.

        Ranma shoved open the sash and settled the window wide open,
stepping out onto the rooftop with careful tread. He moved away from his
own window a bit and settled somewhere nearer to Nabiki's before he noticed
Ryouga standing nearby.

        The moonlight was strong, silver motes of fairydust on the wind as
it settled against Ranma's skin and made him look like polished marble to
Ryouga, strong but brittle all at the same time. With careful tread, he
settled down near Ranma's spot and joined him in staring out over the
pellucid waters of the koi pond, dropping his backpack nearby. He felt
Ranma jump as he placed his hand lightly on Ranma's bare arm, his voice
whisper soft as he murmured, "I didn't know."

        Ranma shrugged, "You couldn't've."

        Ryouga frowned. Ranma could make things a lot harder than they had
to be and he was *still* angry over being dumped into that damned drowned
piglet spring; all the same, Ryouga could feel the need that seemed to seep
out of Ranma's pores tonight, the need for love and comfort and tenderness
that came out in him sometimes when he dropped the macho facade that he
kept up in front of his father and anyone who might question his
"manliness".

        Ryouga leaned to the side and hesitantly put his arm around Ranma's
shoulders, fingers lightly stroking in his nervousness. He could feel Ranma
glance at him from the corner of those beautiful prussian eyes and he
shuddered. It had been years and Ryouga wasn't sure that he could do what
he needed to do tonight, not just needed, but wanted, yearned to do.
Steeling his spine and setting his jaw, Ryouga twisted at the waist and,
with firm hands, tugged Ranma forward against his own chest.

        Their noses bumped lightly but it didn't matter. All that mattered
now was this sudden hunger, the song in their veins that seemed to ask for
more, that made their bodies hum with an excitement neither had felt in
longer than they cared to discuss.

        Ryouga's hands were roaming wild over Ranma's chest as he tenderly
bit into the silk of Ranma's trembling lower lip and pushed him back
against the rooftop to come over him and stare down into the starlit face
that had so entranced him before, eyes that could still convey a thousand
different feelings and emotions and make Ryouga tremble. The passion was so
close to anger for him, both emotions exquisite, ethereal and quick to come
and go. His fingers fumbled at the wooden buttons, unable to pull them open
fast enough as he grasped Ranma's pigtail in his fist and pulled just
enough to open his throat to him.

        Ranma moaned, his heart beating faster and faster as Ryouga moved
over him, lifted his jaw to the insistent tug and shuddered as Ryouga found
a cluster of nerve endings near his jugular. Ryouga's nibbling teeth made
him rock upwards, pressing his growing erection tightly against Ryouga's
belly as he brought a hand into the lost boy's hair, fingers shoving
against the bandanna and sliding away as he cupped the nape of his neck
with a low moan.

        Ryouga could feel Ranma pressed against him, his own excitement
making him breathless as he managed to get Ranma's shirt off, finally. The
heat rising from the breadth of his chest seemed to burn Ryouga's
fingertips as he pressed his fingers in quick, dancing motions up and over
Ranma's navel and along his diaphragm, hands caressing around ribs even as
he bit and sucked his way down to Ranma's collar bone. There was impatience
in Ranma's every motion as he began to work on tugging Ryouga's shirt up
and over as well, parting long enough to tear it off, finally, rolling so
that Ryouga was underneath him and he could see the velvet brown of
Ryouga's eyes gleaming starlight at him and then he bit just underneath the
arm, teeth nipping and tongue lashing out in quick apology when the gasp of
pain-pleasure came.

        The kisses were fast and hard, the hands roaming freely over the
heated iron of muscle. Both were shaking with the boundless fire that
seemed to be eating them alive, making soft moans sound like cries of
pleasure, groans of exquisite agony as pants and underwear and shirts
fluttered and tumbled in the cool evening breeze to fly away and into the
pond. Neither noticed as the wind picked up and blew across sweat-dewed
skin.

        Ranma moved to the side, left arm halfway beneath Ryouga as he
pulled him close and pressed his cock tightly against Ryouga's, the
friction of velvet soft skin and tissue rubbing together bringing audible
moans from both of them. Ryouga could feel the excitement welling up inside
of him, so fast that it seemed only moments ago they'd begun touching and
he wanted more, he wanted it now, he wanted it five minutes ago. Looking
into Ranma's own fervent eyes, he shuddered. Ryouga could see Ranma's
reaction as he reached down with a slightly rough hand to grasp Ranma's
penis and stroke, slow and tight with his hand before he moved down and
down and down, trails of hot kisses buried across Ranma's skin there in the
moonlight, across his chest and down his belly to the pulsing shaft in his
hand. It took mere seconds for him to truly consider the matter before
leaning down and kissing the delicate tissue.

        Ranma's response shook his entire body as Ryouga wrapped his tongue
around the flared corona, tongue tickling across the tiny opening and
dipping to taste the salty fluid that trembled there, Ryouga's lips opening
and, with an almost audible *popping* noise, suckling the head in tightly.
Ranma gave a wild little cry and balled his hands into fists, rolling over
onto his back and somehow carrying Ryouga with him, his lower lip bitten
tightly between pearlescent teeth as his brow knit. Ryouga's hand slid up
and down the shaft behind his mouth as his teeth ever so lightly pressed
against it, shoulders coming between Ranma's thighs as a hand reached to
cup his ass, lifting Ranma to him with titanic strength and then stroking
all the way to the root, almost choking as his throat protested the action.
Pulling back up, Ryouga established a rhythm, several short strokes
followed by a deep one, little noises of appreciation coming from the back
of his throat, his own penis rubbing against the tiles of the roof with
abandon.

        Ranma could feel it, he was so close, almost there, and then Ryouga
pulled away, leaving him to shiver as the wind blew across saliva wet flesh
and to moan in bereavement. Ryouga's hands were trembling violently as he
heard that noise of protest, so much so that he could barely begin to unzip
the compartments of his backpack from where it lay nearby and, once he did,
he couldn't make his shaking fingers hold onto anything.

        Ranma eyed Ryouga with surprise as he pulled out a tiny foil
package and a small bottle of something that looked...well...wet. His pout
was semi-serious as he asked in a husky voice, "You always carry that kinda
thing around, Ryouga?"

        Ryouga grinned as he settled the package on Ranma's stomach and
replied, "Hibiki Family Rule #17: Be prepared for all contingencies." He
winked in a shockingly flirtatious manner as he opened the small bottle and
slid back down.

        At the same moment Ranma felt that tight, hot mouth encase his
organ again, he felt Ryouga's fingers probing delicately, opening him and
sliding just inside of him, gently at first and then pressing deeper to rub
against some part of him that made him gasp. Tremors of pain and pleasure
ran down his spine as his mouth opened in a soundless noise of
unexplainable origins and his back arched up off of the roof, fingers
knotting in Ryouga's hair as Ryouga's hands soothed him, made him hot and
left him a quivering wreck.

        Ryouga could feel it now, Ranma's ki so high pitched that it sang
in tune with his own and he pulled back reluctantly, kissing the hard shaft
one last time, nose rubbing against the tender skin of Ranma's belly as he
withdrew his hands and reached for the package, ripping it open with
shaking fingers and smoothing on the soft latex sheath.

        Ranma looked on in awe, biting his lip and swallowing with sudden
nervous tension. He wanted release so very badly now that he wouldn't
hesitate to do anything that Ryouga asked of him and so he closed his eyes
and heaved a soft sigh of acceptance as Ryouga slid between his legs,
lifted one of Ranma's knees up and over his shoulder and carefully
positioned himself with one hand. Ranma opened his eyes as he sensed
Ryouga's hesitation and "Hmm?" 'ed softly, looking up at him.

        Ryouga leaned down, glad for Ranma's flexibility as his lips
touched the trembling mouth of his lover beneath him. At the moment that
Ryouga's tongue took Ranma's mouth, he pushed forward, slow and gentle, one
hand on Ranma's left hip and the other moving from his own shaft to
Ranma's. He could feel the uncontrollable shaking that seemed to run
through Ranma as he pressed deeper, pushing until he was seated completely
against Ranma's hips. Both boys became a tableau in moondrenched marble,
the larger Ryouga brushing Ranma's face tenderly, listening to the more
slender young man's low whimpers and brushing his mouth every so often
against the gasping one beneath him. With a simple movement, Ryouga moved
Ranma's leg away from his shoulder and wrapped it around his waist, pulling
the other to join it.

        Ranma felt his very heart trembling in his chest, sweat trickling
down the back of his neck as he reached up and grabbed Ryouga's shoulders,
looking deep into Ryouga's eyes and whispering, "Now..." as he pulled
himself tightly against Ryouga, pressing his face against the hollow of
Ryouga's throat and beginning to kiss and bite lightly.

        Ryouga gasped, beginning to thrust now. His movements were timid,
gentle, slow as he felt Ranma's body clamping down tightly around him, his
hand holding Ranma's shaft lightly as it bobbed in his hand, betraying the
pure bliss that Ranma was feeling. His fingers began to stroke Ranma
involuntarily, perhaps in response to the rhythm his own body was beginning
to establish inside of him, and he could feel something building, deep.
Each stroke of Ryouga's hand was rhapsody, each thrust seemed to come
harder, deeper, further, invading Ranma's inner soul and releasing a
tension that he had never realized was there. Both were trembling, shaking
with the force of emotions and the feel of hyper-sensitive skin brushing
one against the other. Ranma could feel it again, surpassing the plateau
that he had reached earlier while buried inside of Ryouga's mouth. Ryouga
felt it as well, his arms wrapping tightly around Ranma's shoulders,
holding him closely as his thrusts became harder, ragged, rapid, Ranma's
cock brushing Ryouga's stomach in time with Ryouga's motions.

        Ranma came to fulfillment first, with a sharp gasp and a sudden
stillness of his body as he could do no more than tremble under Ryouga's
continuing motions, tightening around Ryouga in pulses, his eyes shut
tightly as tears began to stream, running down the bridge of his nose and
tickling his earlobe as they dripped off, crystalline shards of salty
water. Ranma's release seemed to trigger Ryouga's own -- he gasped sharply
and thrust deep one final time, wrapping his arms even more tightly about
Ranma as he practically fell atop him, gasping for breath and shivering
with release.

        Several moments passed before either moved. Ryouga was the first to
do so, reaching behind him and carefully unhooking Ranma's ankles, settling
his feet down flat against the roof as he withdrew slowly, hearing the soft
hiss of breath that Ranma gave. He glanced down at Ranma's stomach and his
own, and suddenly laughed.

        Ranma roused himself enough to look irate and ask, "Ermm... what?"

        Ryouga leaned down and carefully ran his tongue over a strand of
the salty ejaculate, making a little face at the taste before he leaned up
to kiss Ranma with a tender stroke of tongue and mouth. Ranma wrinkled his
nose, as well, but opened his mouth all the same, quite willing for the
ravagement of Ryouga's tongue.

        Ryouga moved to lay beside Ranma, his hand searching and finding
Ranma's as the frogs croaked and the crickets sang. It was quiet for
several moments before either of them spoke, as if it would take that time
to disentangle all of the confusing emotions that had been brought back
into play after so long.

        "What about Akane?" Ryouga whispered, breaking the silence with his
soft, thrumming voice.

        A shiver ran through Ranma's frame as he sat up, looking around for
his clothing and (upon glancing towards the pond) seeing it floating on the
surface of the koi pond. With a soft sigh, he shook his head. "I..I dunno,
Ryouga. I'm so confused..." He reached up and rubbed the bridge of his nose
in a nervous motion, propping one forearm on his knee as he reached to cup
the back of his skull. He sighed softly and looked out over the back yard,
rubbing his neck contemplatively. "It ain't just Akane, neither. We've
gotta worry 'bout Ucchan and Shampoo and," here, he shuddered, "Kodachi. I
mean.. I don't feel nothin' for any of THEM, but...still...they ain't gonna
like it if we just take off."

        "So you're saying you feel something for Akane, but not the others?"

        "I didn't say that!" Ranma backpedalled furiously. "I didn't say
nothin' like that. Just..." He bit his lip and looked miserable. "Just
I'm...confused. Gimme some time, Ryouga....A little time."

        Ryouga drew himself up icily and stood, making a face as he pulled
away the remains of the condom and tossed it and the ripped up package into
a small paper bag from his backpack. He began to pull on clothes with jerky
motions of his hands as Ranma watched helplessly, his eyebrows knitting in
a worried sort of pain. "Just a little time, Ryouga. That's all. Surely
that ain't so much to ask..." Ranma half pleaded.

        Ryouga turned to Ranma as he pulled a yellow shirt over his head
and knelt down to tie the laces tightly around his pant's legs. "All right,
Ranma. You've got your time. From now 'til the next time I find the dojo
again," he said softly. "I'll expect an answer then."

        With that pronouncement, Ryouga lifted his backpack, found his
umbrella and leapt down from the house to walk into the night, leaving
Ranma naked and alone to search his soul for what he hoped would be the
right answer.

        *****************************************************

        Whew! I didn't think I'd EVER manage to finish that up ^_^ But
there ya have it. Somebody said I should get in on the yaoi bit
*coughcough* *er..well..* and I had some ideas and then some more and not
all of them were necessarily comfortable ones, but what they amounted to
was a set of four stories of which this is the second. The third may be a
week or more in completion (depending, of course, on how willing my bosses
are to turn an eye to all of my typing -- but then, all I really hafta do
is answer the phones, so that seems to be perfectly all right most of the
time.) ^_^  AT ANY RATE -- this will be followed by two others (well,
perhaps three. Everything is outlined and I have to discover points at
which I wish to break off.)

        Comments welcome, flames should be careful 'cause this is a shared
email address and it would be impolite to say nasty things to somebody
besides me. Not, of course, that Risha-chan doesn't expect it -- she finds
my proclivities quite charming. ^_^ Friends usually do...er... I'm
babbling, aren't I?

Tzigane

        ***************************************************
        *  If I die let it be with you...                 *
        *  Hold me close while the world falls in on me.. *
        *  Whisper my name as the darkness rises...       *
        *  And I fall into the dream that never ends...   *
        *      From:"The Scarlet Letters" by Scott Urban  *
        ***************************************************





                        -=*Total Eclipse of the Heart*=-

        To say that Akane was in the midst of one of her biggest storms of
fury yet would be a vast understatement. As a matter of fact, the
undulating waves of sheer malevolence that were twisting inside Akane's
soul at that moment would probably make Satan himself turn and run
shrieking like a girl.

        Tears of anger began to stream down her face as she choked back a
sob. How.. HOW... DARE HE!!! THAT PERVERT!!!

        ******************************************************************

        The day had started out well enough. They usually did, or so Akane
thought. Ranma had been dumped in the pond twice already that morning, once
by his father and a second time when Akane had used the table like a
baseball bat to send him flying through the back door and into its depths.
She had spent a couple of hours cooking with Kasumi, beaten Ranma once more
for mocking her cuisine and then marched to her room to spend an hour or
two cooling off and reading for her English class -- poetry that seemed to
sing with life. She was just beginning to find the rhythm and beginning to
understand what "Goblin Market" meant when a tentative knock came on her
bedroom door.

        "Come in!" Akane called quietly. Nabiki slipped through, shutting
the door carefully behind her. A worried expression was plastered on her
face, one that Akane hadn't seen in many years -- not since before the
death of their mother, in fact. It sent shivers down her spine and
frightened her in more ways than one.

        "What's the matter, oneechan?"

        Nabiki bit her lip, not daring to look Akane straight in the face,
looking instead down at the toe of her shoe as if it was of great
importance. "Akane..." Her voice was tentative, quiet as if in reflection.
She spoke up, tilting her chin back and looking into Akane's startled eyes.
"Akane, I've been keeping something important from you. Something that you
should know. I should have told you a week ago, but..."

        Wordlessly, Nabiki handed Akane the VHS cassette that she had
cradled at the small of her back. With a deep breath she sighed and turned
to leave, turning back only once to say, "Don't kill him, ok? I'd hate to
see you in prison...or worse."[1] With that, she stepped from the room,
leaving Akane alone to drag out the miniature TV and the small VCR that
Nabiki had sold her some months ago when she began upgrading her own
equipment.

        It was then that Akane saw exactly what a pervert her iinazuke
really was.

        ******************************************************************

        Somewhere deep inside of Akane's soul, there lies a rational being.
A being who, in moments of intense stress, destroys the rancorous hostility
and replaces it with a sense of...calm. With a single click, it seemed that
she became a different person, one who had to seriously consider every
angle of what she now saw as 'the problem'.

        Quite simply, Ryouga was the problem.

        Of course, they'd been friends, but after this sort of betrayal...
the seduction of Ranma...Akane didn't feel that she could forgive him.
Certainly Ranma would never willingly behave in such a manner unless he was
extremely confused. True, there were some gender identification problems
there and Akane should have tried to help him with them before now instead
of making them worse, but the sheer notion that Ranma would knowingly
commit the act that she had now watched *twice* just to be sure was...
well... Impossible.

        Akane scowled, crossing her arms across her chest. Really, it
wasn't like she loved Ranma or anything. "As if," she fooled herself. "He
isn't that lucky!" She had to admit, though, that Ryouga was a worse threat
than the other girls. After all, he'd managed to get into Ranma's panties,
so to speak, and that was something that Shampoo hadn't even been able to
do on her best day.

        Sitting down at her desk and pulling out a sheet of paper and a
ball point pen, Akane began to make the list for what she would need to get
Ranma back for what he had done with Ryouga -- at ANY cost.

        ******************************************************************

        Ranma frowned as he paced back and forth inside the dojo. He could
practically smell some kind of plot brewing against him, and he had no idea
where it was going to come from. He knew this peace couldn't last. It was a
wonder he'd had any time to think at all.

        With a resigned sigh, he dropped down in the center of the dojo in
a lotus position and put his elbow on his knee so that he could prop up his
chin with his hand. This decision was turning out to be more difficult to
make than he had thought that it would be. He truly believed, now, that he
loved Ryouga. That had been one of the most difficult and disturbing thing
that he had ever admitted in his entire life, even to himself. "Still, I
can't just get up an' leave Akane. I mean.. I..I think I love her, too," he
thought dismally.[2]

        He could hear the music of her voice outside as she wished the
family a good evening. It was Akane's turn to cook, again, and he was being
left behind as her resident guinea pig. He sighed deeply and rubbed his
aching forehead with the palm of his right hand. Dammit, things just had to
get easier. He knew the answer that he was going to give Ryouga when he
finally returned to the Dojo -- there was only one answer that he could
give him, truthfully. Now if he could just figure out what to do about
Akane...

        "Ranma!" Akane called from the back of the house, "dinner will be
ready in fifteen minutes!"

        Ranma eyed his stomach dispassionately. Might as well go ahead and
start eating the antacid tablets now, he supposed. With a sigh, Ranma rose
and pounced up on the roof and into his room.

        ******************************************************************

        Akane put the finishing touches on everything, right down to the
drops of solution that would send Ranma into a deep sleep long enough for
her to get him right where she wanted him. {Fire with fire,} she thought
dryly, a high flush spreading across her cheeks with her nervousness as she
replaced the little bottle in her bookbag and set it down near the back
door. No point in taking any chance of someone finding it and guessing what
was going on, now was there?[3]

        She carefully set all of the food out on the table and eyed it
dispassionately. Well, it wasn't Kasumi's, that was for certain, but it
certainly wasn't her usual fare, either. That cold little voice in the back
of her head had assured her that if she slowed down and just paid attention
she would be able to cook something that was reasonably close to edible, if
not entirely enjoyable. Since her family was always utterly terrified of
her cooking and had left, she'd have a good four hours alone with Ranma to
cement her plan firmly.

        THIS was a good thing.

        With a light tread, she slipped out to the dojo, pushing one of the
doors open silently and peeking in. "Ranma, dinner's all done. Are you
coming?"

        "Hey, Akane," came the voice from the back door of the house, "this
stuff actually looks edible!" Then came a suspicious, "What'd you do to
actually get it t'look NORMAL?!?"

        "Are you saying that my food DOESN'T ordinarily look NORMAL,
Ranma?!" she demanded irately, one eyebrow rising. Pleasure rose in her as
she saw him backpedal rapidly, his hands going up in defense as he half
stumbled in the back door in an attempt to get out of the immediate line of
fire, babbling almost mindlessly. She had never really paid much attention
to Ranma's attempts to placate her before but she sort of liked the idea of
it. A quick picture of Ranma begging her on his knees flitted through her
mind and she had to cross her arms and give a furious frown to suppress the
giggles that wanted to come from her so effortlessly.

        Ranma knew it. Just by looking at it, at the sheer malevolent
NORMALCY of it, he knew that he was probably going to be praying for his
stomach to come unwrenched from the knots this stuff would put in it within
the next two hours. While the thought of it was a little more than
upsetting, the look on Akane's face told him that it just wasn't worth the
malletting that he was going to receive if he *didn't* eat it. With a gulp,
he seated himself at the table and tentatively picked up a pair of
chopsticks. He poked it lightly, one eye squenched shut in fear, the other
burning as a drop of sweat slid into the corner. With trepidation, he
lifted a mouthful of the stuff and slowly began to chew... Wait! Wait!!!!
NO way could Akane have cooked this... why.. why.. it even TASTED edible.

        "A..Akane..." he whispered, coughing slightly, "this is GOOD."

        Akane smiled at him demurely. "I've been working on it," was her
only comment as she lifted a bite of rice to her own mouth, watching him
carefully as he began to shovel down food in Saotome-esque manner. It
wasn't long before his eyelids began to droop and he began to yawn, his
food tumbling to the floor in a spill.

        Akane smirked to herself as Ranma's head hit the table. Ha. SHE'd
show that idiot what kind of woman she was, and if he *EVER* betrayed her
again, she'd pound him so hard that he'd never know what hit him.

        ******************************************************************

        It was dark when Ranma woke and he could feel something covering
the upper half of his face. As he tried to open his eyes, he could feel his
lashes brush against something soft, something keeping him from seeing. He
tried to reach a hand down and pull whatever it was away from his face, but
neither would move. Almost experimentally, he tugged at an ankle as well,
lips pressing together firmly as he realized that he was quite well bound
and that he wasn't likely to get loose any time soon. An intense feeling
of.. something like *fear* seemed to spread through him as he rapidly tried
to alert himself to his surroundings. Ranma still felt a little groggy, but
he could hear movement nearby and he knew that he wasn't alone.

        "Who's there?" He cringed as his voice cracked slightly on the
notes, his hands trembling violently as he balled them into helpless fists.

        "Who do you think, Saotome?" came a gruff whisper, the voice unlike
anyone's that he knew. Fury welled up inside of him as he began to struggle
uselessly before feeling the soft curves of a female body settle onto the
bed beside him. His heartbeat accelerated quickly, going wild inside of his
chest. The grammar gave enough of a clue to know that it wasn't Shampoo.
Ucchan would never, ever do something like this and Akane would die before
she touched him... so it could only be Kodachi by process of elimination.

        "What've you done with Akane, you .. you..." he growled ferally,
pulling at the bonds frantically even as the girl's soft hands roamed over
his pectorals and down the front of his satin shirt.

        "What makes you think that I've done anything with your precious
Akane?" came the taunting whisper as the girl trailed her fingers down
across his hip to press against his cock with firm fingers, purring softly
at the throbbing response even as his body tried to shy away from her.

        Akane stood back and looked down at Ranma dispassionately. He
really was beautiful like this, body stretched wide, hands above his head..
So helpless, the dark locks of his bangs brushing his forehead and the
white silk of the scarf that she had used to blindfold him. Admittedly,
frightening him like this WAS a bit much, but he was so irresistibly sexy
when he was frightened just this tiny bit!

        With careful tread, she stood and walked to her dresser, opening
the top drawer and smiling. She pulled on the pair of surgical gloves that
she had borrowed from Dr. Tofu earlier yesterday with deft hands and
withdrew a shoebox that rattled and clanked with the various items held
within. Turning, she shook the box as she walked back to the bed, smiling
at the way Ranma winced each time she did so.

        Ranma shook with fury and fear. THIS was NOT funny. He couldn't
even tell if he was somewhere that people might hear and find him in this
humiliating position! This was something out of a nightmare, a nightmare
that he'd left behind a year ago when they came to the Tendo's house and
settled into a civilized way of life. He began to cry in anger, tears
soaking through the blindfold as he shuddered violently, hands still
tugging valiantly but only tightening his bonds. His vociferation came
growling to cover the choking breaths, "You bitch!! LET ME GO!!!!!"[4]

        Akane shook, taken aback by the violence in his voice as she
reached out a latex covered finger to gently trail across his jaw-bone,
leaning forward to kiss his forehead tenderly. As her chin brushed the
blindfold, she could feel the wetness there.

        Akane jerked back in surprise. Ranma.. CRYING!? Her hands pressed
against his face gently, holding him still as her lips gently pressed
against the soft wet material. Her heart began to ache inside of her and,
no matter how badly she wanted to revenge herself upon his body for daring
to betray her with another man, she couldn't help it when she reached
behind his head and tugged, pulling the knot loose with quick motions of
her fingers.

        Ranma shuddered, turning his face aside quickly to hide the tears
that were now free to tremble and stream down his face, his wrists aching
before he felt the ties being loosened just enough so that his circulation
wouldn't be cut off. Shaking his head slightly and forcing back tears of
mortification and anger, he turned his face to look into that of his captor
and found...

        AKANE!?

        Her fingers traced gently along the curve of his ear and down his
throat as she leaned forward to capture his mouth with her own, a soft
'shhh' whispered just before her lips brushed his own and then opened,
teasing him as her tongue darted inside, kissing him roughly. Ranma could
feel his mouth bruising underneath the force of hers and he moaned
helplessly as he opened beneath her. Ranma had never imagined Akane doing
something like this to him -- sex had never really crossed his mind when it
came to his fiancees -- it would have caused too much trouble. Instead, the
fact of the emotions that he felt for Akane had always seemed to overwhelm
him and make him shake with the intensity of it. This intensity was a
different kind, a kind that made his entire body feel as if he were going
to explode at any moment and he wasn't sure whether that explosion was fear
or pleasure or something more cataclysmic that he couldn't even name.

        Akane fumbled, fingers shoving off the top of the shoebox as she
withdrew the knife and brought it to gently touch against Ranma's cheek,
whispering that soft 'shhhh' again as his eyes went incredibly wide,
sparkling sapphire fear coming to life in them as she settled back and
straddled his hips, pressing against him in her white cotton panties. She
lightly trailed the blade along, barely touching his skin and then she
began to cut the buttons from his shirt, one and then another and then
another until she could brush it open, the satin soft against her fingers.
She traced a tiny, scratched pattern against the hard muscles of Ranma's
belly and heard him moan, half in fright and half in some sort of
inexplicable ecstasy. She flung the knife into a corner and pulled off her
cotton t-shirt, leaning down to kiss him again, hard, her breasts pressed
tightly against the warmth of his chest, teasing, titillating, feeling her
nipples and his own brush against one another, the hard little kernels on
his chest exciting her immeasurably.

        Ranma shuddered, this unexpected assault on his body making him
arch wildly, pressing up against the heat of her. He could feel her wetness
through the soft material of his pants and he yearned to be pressed deep
into that warmth, listening to her moan his name. Her hands were working on
him, kneading the muscles of his chest and arms as he closed his eyes to
groan helplessly, enjoying every motion and movement that she made against
him.

        Akane slid the leather strap from the box soundlessly, one hand
still caressing across his chest as she sat up and wrapped the end with the
buckle into her palm.

        The first touch of the strap as it flickered across a nipple
brought him to rough awareness, his eyes shooting open with fear and then
some kind of pleasure, the shock waves of it reverberating through him
again and again, making him moan wildly and toss his head to the side
against the pillows. Akane watched him thoughtfully as she carefully
brought down the strap, again, again, again, until there was a fine
crosswork of red lines working its way across his chest and arms and his
breath was heaving and his erection began to flag slightly.

        He felt her tongue tracing each delineated stroke of heat and he
groaned low in his chest, feeling himself becoming even harder than he had
been previously, hands balling into fists once again with the desire to
wrap in the short strands of her beautiful dark hair, his breathing quick
and sharp as she moved up to straddle his stomach, tugging at the ties of
his pants behind her and jerking them down past his hips along with his
boxers, causing him to wince as his cock tangled in the waistband just so.

        Akane moved down, settling between his thighs and leaning forward
to timidly lash out her tongue, the tip of it teasingly stroking across the
tiny stretch of skin that 'attached' the head of his penis to the shaft,
taking it between her teeth and lightly nibbling. Her fingers trembled as
she opened a small jar of lubricant and coated her latex covered fingers
with them, stroking his shaft gently with the wetness of them as she opened
her mouth and popped the head of his cock into her mouth to suckle tightly,
listening to his moans of pleasure.

        Ranma felt as if his veins were on fire, body writhing against the
cotton sheets of her bed as he trembled, half-naked, against her. He could
feel her fingers stroking his cock and then down to lightly caress the nest
of his testes and then farther, parting him and stroking to find his anus,
fingers tormenting him with the promise of more and then they were inside
of him, two fingers the equivalent of one of Ryouga's opening him wide,
making him give a strangled moan as his body jerked and he threatened to
come in her mouth, trembling violently in the cool air.

        Akane backed away, eyeing Ranma's face dispassionately, her fist
closing about his shaft in lightning swift strokes as her fingers thrust
deep, brushing against some spot inside of him that seemed to be driving
him wild. She could feel all of his muscles tensing beneath her as he
strove valiantly to prevent the inevitable, the stress of the situation all
pouring into his struggle as he gave a strangled little moan and came, wild
and shuddering as his eyes closed and he sobbed once, twice as semen
spurted over Akane's tugging hand and all over his belly.

        "Well," Akane mumbled to herself, "that was interesting." Beneath
her, she could feel Ranma's shudders as he slowly regained control of
himself. Still, she thought, this wasn't really enough. Her own body was
yammering, a constant low heat in her belly filling her world as she eyed
him, laying there in his cut open and half on clothing. His cock shimmered
with the remnants of semen and she reached down to lightly touch the head,
smiling at his soft hiss of protest. Her new playtoy seemed to be extremely
sensitive and so she began to gently stroke with the palm of her hand,
listening to his soft sobs of protest as he began to regain the rigidity
that she so prized. With a quick motion, she stood and stripped away the
remnants of her clothing, growling softly as she straddled his chest and
leaned forward. With sure hands, she tugged his head up to her breast, a
mute order.

        Ranma's entire body felt abused, his unwilling response draining
him as he moaned, opening his mouth to gently capture the berry colored
nubbin of her nipple and nurse, his tongue and teeth ever so gentle as he
began to nip, teeth sharp, tongue stroking lightly in apology. Her excited
whimpers and the dampness that he felt against his diaphragm were proof of
how well his technique was working and he gave an audible groan as he began
to roam across the tender skin, moving his head to pay attention to both of
them.

        Akane quivered with excitement, teeth gritted tightly to keep from
shouting out her joy at the feeling. THIS was a thousand times better than
touching herself, this feeling of being pleasured. Reaching back, she could
feel Ranma hard against her palm and, as much as she wanted more of the
exquisite touch of his tongue and teeth, she knew that she wouldn't last
much longer and neither would he.

        She tugged gently, fingers wrapped around his braid as she pushed
him away from her. His little sound of protest was perfectly adorable and
she felt more than just sexual warmth fill her as she slowly laid down on
top of him, kissing him with delicate precision, tongue dipping against his
own even as her hands aimed him towards the core of her being. The first
time, she missed and as he slipped from her grasp, the velvet skin of him
brushed against the core of her pleasure. That single motion sent frissons
of rapture down her spine and she gave a sharp cry, arching her back and
pressing her hand to Ranma's stomach. Her fingers trembled wildly as she
reached between her body and his own to take him between her fingers and
aim him carefully against her entrance.

        Ranma shuddered as he heard Akane cry out, tremors shaking him as
her soft hands took him into her grasp and guided him to the doorway of her
passage. He was straining against his bonds for all he was worth but it was
as if they were made of steel; thus, he did the best that he could and
pressed his hips upward.

        Akane felt the trembling push and sat up to begin shoving downwards
in accordance, moaning audibly with each centimeter. It wasn't long before
she gasped in pain and looked astonished, rising again and whimpering.

        Ranma opened his eyes in confusion, biting his lip and groaning low
in his throat, "Akane?" as he continued to attempt to probe her, moaning as
she pulled even farther away.

        A determined look crossed Akane's face as she leaned down and
kissed him, hard and quick, searching. His response was a thing of beauty,
openness, pleasure, an intense combination of things that sent shivers down
her spine and made her cry out softly. Bracing her hands on each of his
shoulders, she rose and, trembling, opened wide and pushed her hips
downward with a single hard stroke.

        Ranma gasped, a sound of pain as he felt the head of his cock press
*tightly* against something just inside of Akane and then moaned in
accompaniment to her keening wail of anguish as he burst through it,
breaking her maidenhead with vigor. He 'oofed' as her elbows came down hard
on his chest, her body writhing atop him as she shook her head back and
forth, tears dripping. The feeling was exquisite for him, so tight and soft
and wet and beyond compare. He turned his head to the side and moaned
against his arm, lashes brushing his cheeks as he arched again, placing
himself deeper inside of her.

        Akane's mind was a whirl of confusion. Somehow, this felt so good
and yet it hurt so much and she wanted to stop but she didn't ever want it
to end! Nabiki hadn't explained about this pain when she had given Akane
the lecture about the "birds & the bees" all those years ago. In an absent
minded sort of way, she wondered if Nabiki even know about it. She could
feel a wet trickle between her thighs and wasn't entirely sure what it was.
All she knew was that it helped to make that burning pain a little easier
to bear and she didn't mind that at all. With careful movements she began
to undulate her hips, gasping as she rose above Ranma and then plunged
downwards, nails cutting little half moons into the skin of his hips.

        With the strength of ten, Ranma gave a savage growl and pulled hard
against his bonds. The bedposts snapped where the scarves had been tied and
his hands flew forwards, fingers meshing in the short strands of hair as he
pulled her down to kiss her, arching his hips upwards. His fingers roamed
her body wildly, gently pinching her nipples and finally moving between
them to the juncture of her thighs to explore that place that had caused
her to cry out so loudly and arch back wantonly. His fingers found her
clit, unhooded in the excitement that flowed through her, and he began to
rub expectantly.

        Akane moaned, a keening sound of pleasure as he stroked her just
right, shaking violently with every touch against the sensitive little
organ. She moved atop him with abandon, hips rising and falling as she
sought something just out of reach, something that his touch brought that
much closer as her hands roamed his arms and chest with hunger. She rocked
forward, shaking her head violently, and with the sudden brush of his thumb
in just the right place, Akane exploded into slivers of light and sound and
color and ethereallity, muscles clamping down tightly around Ranma's shaft.

        Akane's orgasm was timed almost perfectly. Ranma moaned sharply and
grasped her hips tightly to continue thrusting deep inside of her quivering
orifice for a few seconds before he thrust hard and to the hilt inside of
her one final time, flooding her with his seed, his back arching up off of
the mattress.

        Akane crumpled down against Ranma's chest with a low moan,
reverberations of pleasure still rippling across her skin as she laid her
head against his shoulder sleepily and yawned. Silence fell in the
dusk-filled room; the only sound that could be heard was the light brush of
skin against skin and mouth against mouth.

        ******************************************************************

        Ryouga watched silently just outside of Akane's window. Tears
dripped in steady trails down his pallid face and his heart ached in his
chest with an intensity that he had never known before. A greenish- yellow
tinge outlined him slightly as he raised a hand to absentmindedly brush
away the crystalline shards of sorrow, head bowing low. He had lost him;
no, not just him, because Ryouga was never entirely sure that he *had*
Ranma to begin with. He had allowed hope to rise in his heart for the first
time in years only to find that it had been crushed ruthlessly beneath the
heel of someone else's passion. He had lost them both, and there was no
room for a Lost Boy such as himself in their hearts.

        With a dejected sigh, Ryouga jumped down from the rooftop and stood
silently beside the pond for a moment as if bidding his good-byes. With
that, he trudged despondently away, more alone in the world now than he had
been only hours before.

        ******************************************************************

        "Akane?" Ranma whispered softly against her ear as he held her
tightly, arms wrapped around her waist as he nuzzled gently at her neck.

        Akane yawned and gave a soft, "Hmm?" in response, enjoying the
light nuzzling feeling.

        "Akane, we gotta talk," Ranma said firmly, pushing her gently to
the side and sitting up to untie his ankles. As soon as that was done, he
turned back to her and took her gently into his arms.

        Akane blinked at being put to the side and then curled up against
the heat of him as he laid back down. "What's so important that we have to
talk about it *now*, Ranma?" she asked with a slight frown.

        Ranma looked sheepish and hurt and confused all at the same time
and whispered softly, "Ryouga."

        Akane started from her pleasant half-drowse, eyes narrowing at the
name. "What about him? You love *me*, don't you?" She batted her eyelashes
and smiled especially cutely, hiding the venom that she had once expressed
so freely.

        "Akane," Ranma whispered in a strained voice, "I can't just LEAVE
him. He's my friend! We've been... very.. ahh.. very close, until now,
until you, until this damned curse! And now I don't know what I want except
that...that...," he rolled away from her and into a miserable ball to
murmur softly, "except that I want you both." A tremor worked its way
through him as he closed his eyes and turned his face into her pillow. Her
scent lingered there and it was so tempting to say that he loved her and
her alone and yet, somehow, he couldn't because he didn't want to cheapen
her with that sort of lie. The truth was simply that he loved Ryouga as
well, and he wouldn't lie to her about that.

        Akane could feel herself stiffening with each word, each gesture.
As he pulled away from her, she closed her eyes tightly to stop the burning
only to realize that they were full of tears and she couldn't stop them
from spilling over as her fury drained away and left her empty and aching.
"Everyone has to make choices, Ranma. No one can avoid them forever -- you
least of all," she said, her voice husky. She stood from the bed and began
to draw on her clothing, eyes focusing on the floor. As she buttoned the
last button and slipped on her socks, she walked slowly to the door and
pulled it open to walk out when she heard it -- that soft catch of breath,
the tremble of his fingers as he clutched her pillow, the tremors that
shook his shoulders. There are many things in this small world that a woman
may resist, from chocolates to roses to walks in the park, but there is one
thing that will make her heart tremble and her eyes fill with tears every
time -- the sound of a lonely voice sobbing in the dark, little boy lost.

        Akane stood in the door for what seemed an eternity but could have
been no more than two minutes before she moved back into the room and shut
the door quietly.  Her hands gently smoothed back his bangs from his hot
forehead as he moved to bury his head in her lap and sob ever so quietly.
"It's all right," she whispered softly. "All right. I'm here, now...
shhhh..."

        With those words, she gently lulled him to sleep.

        ******************************************************************

        [1] Even Nabiki has some kind of a conscience -- surely she
wouldn't charge Akane for something so important?
        [2] Typical. Can't make up his mind about ANYTHING, can he?
        [3] Just a note -- THIS IS A BAD IDEA!!! Drugging anybody is
stupid,    dangerous and illegal in most states. *grumbles* *but then, what
ISN'T illegal here.. ^_^*
        [4] See "Father Figure" and "Blood & Fire".

Post-notes:

        Well, it's sort of like this. I set out to write this series to
prove a point (Y'know, Ranma the bisexual as opposed to all of the other
possibilities out there) Problem *IS* that Akane didn't want to cooperate.
Yikes, she wasn't just unwilling to cooperate, she was on the verge of
Bobbitization (and then decapitation... *eyes the scary looking female with
the mallet standing nearby*) Umm.. yeah. As I was saying... All of the
howls of "PERVERT" and "idiot!" crossing my screen were the tiniest bit
frightening, so we had to come up with a compromise. That is to say, she
got to scare Ranma a little (Okkkeee, maybe more than a little. Maybe a
whole LOT...) and he came out with all of his appendages and she'd consider
forgiving him. Well.. maybe not forgiving him... maybe .. well.. *scratches
head* Maybe just leaving him with all of his appendages ^_^ I really don't
MEAN to make Ranma a weepy baby... it just.. er.. well, it just happened
that way ^_^ I'll be honest, *I'd* cry if somebody tied me up and *I*
didn't know who it was.... *frown* Hmph. Poor Ryouga. Hurting Ryouga is a
very, very, very bad thing and people who do that should be stripped,
covered in honey and staked out over the nearest fire ant bed. (Err.. that
isn't too strong, is it?) ^_~ Wait for the next installment and maybe we'll
get a happy ending somewhere in here... *grin* Or, if not happy, at least
one that we can all live with... Hopefully, it won't take six weeks to
finish *that* one up... *grumblegrumble* All I'm asking for is a little
cooperation... now if I could just talk Akane into behaving properly!




    ***********************************************************************
    *      "My love for you is fathomless...a thing of darkness..."       *
    ***********************************************************************
    *       http://www.geocities.com/Tokyo/Towers/6451/fanfics.html       *
    ***********************************************************************
    *                    The Church of the Black Rose                     *
    ***********************************************************************
    * http://www.geocities.com/Tokyo/Flats/3356/ChurchoftheBlackRose.html *
    ***********************************************************************


                      
                                 "Stone & Pearl"

 "All these mixed emotions/We keep locked away/Like stone and pearl/Stone and
        pearl devotions/We keep locked away/From all the world..."
                                        Savage Garden, "Tears of Pearl"

        ******************************************************

        Ryouga clenched his fingers into a fist as he glared red-faced at
the sign for the Tendo Dojo. Three days. THREE DAYS...he had been
wandering, trying
to leave Nerima. It felt like an eternity and the more he thought about it,
the angrier he became until he wanted to scream vociferations of fury,
frenzied rage that made him glow and made him ache and made him want to
cry. He'd lost them both!! In a single night!! Damn them, damn their souls
to hell! The anger took hold of him, drawing him closer -- and then he
heard the panting breaths and cries of his beloved Ranma's girl form in the
dojo and his own feet took him forward.

        ********************************************************

        Ranma practiced with her female body, moving, twisting, writhing,
bending, elbow back, forward, shout, high kick, train the flexibility to do
what you want it to do. She could feel the sweat at the nape of her neck
causing the loose hairs of her braid to curl into ringlets, could feel it
gathering beneath the curve of her breasts. She closed her eyes to
concentrate on the feeling. The sensation was... interesting, to say the
least. He didn't feel anything quite like this in his masculine body and he
was intensely curious about this feeling now that he had Akane to think
about. A smile flickered across his face and he swung one of his delicate
feminine fists forward, eyes still shut, imagining the way in which it
would impact...

        ...and felt it stop cold.

        Ranma opened his eyes, but it was too late. His shirt had already
gone flying across the dojo floor, ripped from his back, and he cried out
in surprise as his wrists were grabbed tightly and ground together in
Ryouga's hands. "Ryouga!! What are you doing!?" Ranma moaned in pain as he
bruised her by shoving her down onto the floor.

        Ryouga growled, trying to hold down Ranma's lithe, struggling,
female body. "SHUT UP, YOU!" was his only response as he worked her pants
down to her knees. Ranma almost got away at that point and so the pants
didn't go any farther.. But Ryouga's hands did, up to his own to pull and
tug and open quickly as he slapped Ranma, dazing her. The exhilaration of
catching up to Ranma and actually *defeating* him at something (never mind
that it was by a sneaky trick) filled his veins and his mind and made him
throb.

        It was then that it struck him.

        Ranma was crying.

        *His* Ranma. His Ranma that he loved so.

        Ranma's heaving breaths were almost like keening cries of grief as
she turned her face away, struggling ended. She had gone totally limp in
his arms, not fighting, not even acknowledging his presence, and that
wasn't what he wanted. He..he wanted her to know that he was here. He
wanted his Ranma, him, her, she, he, to know that he *LOVED* him, adored
him, wanted nothing more than to see that he was never hurt again and, now,
here he was, hurting Ranma even more by...this...filthy degenerate act!

        Ryouga cried out and pushed himself away, almost falling backwards
as he began to prattle, a thousand apologies spilling over his babbling
tongue as he watched Ranma cry, guilt settling into his bones and making
him shudder. No! No, how could he have almost....when he knew about his
father and about... WHAT could he have been thinking!?

        Ryouga gathered her to him, his mouth kissing at the trails of
tears, lightly licking them from her cheeks as they fell, her mostly naked
body pressed tightly in his arms. Soft, soothing noises were whispered into
Ranma's ear as she sobbed against Ryouga's shoulder, so frightened, so
utterly terrified of what was going on that it was a wonder she was that
coherent and not catatonic, as she was in full Cat Fu mode.

        Ryouga's hands tenderly brushed her hair away from her face, the
sweaty tendrils clinging as he gently cupped the nape of her neck and, with
a whispered, "I'm so sorry...", took her mouth with his, gentle and warm
and sweet, somehow different than kissing boy-type Ranma, the lips beneath
his own just the tiniest bit softer, more receptive.

        Ranma shuddered violently, afraid, afraid, afraid. That emotion had
run through him FAR more often of late than he liked. He had tried for so
long to put up that brave front, not to let anyone know the things that he
was afraid of, cats, the dark, his father, this violence that Ryouga was...
was.. She sobbed harder, moving her face to rest against the curve of his
neck.

        Ryouga gently began to stroke the bruises on her wrists in apology,
his hands ever so gentle as he stroked up the warm skin of her arms,
wrapping his own gently about Ranma's shoulders to hold her there against
him. The shuddering realization that her bare breasts were pressed against
him made him hot, flushed, and his mind almost stuttered over the fact that
there was a naked *WOMAN* in his arms. The sudden insight that this was
Ranma, his Ranma, his lover and beloved, his *male*, struck him at almost
the same moment and he relaxed, nose bleed staved off with a soft sigh.

        Ranma stopped shuddering and lay quiescent in Ryouga's lap, soft
sniffles the only sign that he'd been crying. The sudden need for a
different kind of comfort filled her and she began, feather soft, to kiss
Ryouga's throat, nipping, light, teasing. She could feel the shivers
preading down Ryouga's spine as she whispered into his ear, "Just 'cause I
ain't the same sex don't mean that you can't love me, all the same,
Ryouga..."

        Ryouga reached his hands up and grasped the firm globes of her
breasts in both palms, moaning. The best of both worlds, one might say, he
thought blearily even as Ranma melted against him, her mouth on his own,
tongues tangling as she bit him, ever so gently. He could feel her kicking
her pants the rest of the way off and so he reached between her legs and
felt Ranma...freeze, stone solid and immobile.

        Ranma could almost feel his eyes crossing and rolling back in his
head all at the same time as she gasped frantically for breath. That spot!
Ohhhh, that spot, and he wanted Ryouga to touch it again and he thought
that he'd keep in mind how wonderful that feeling was for the next time he
had sex with Akane because *that* spot was *very* *very* good.

        Ryouga bit into her, him, his angel, his beloved, hungrily, wanting
and craving and yearning and desiring and already he had run out of
patience and he wanted to take Ranma, bend him and take him and make him
moan in pain-pleasure with the thick thrust of his prick and the fingers of
his left hand slid to the woman's opening that amazed him so even now and
the digits skittered across the wet opening lightly, pressing just a bit,
feeling a tiny barrier inside and he moaned, surprised that his Ranma was a
virgin. The sudden thought flickered through his mind of the spring
afternoon that they'd gotten lost and camped next to a sparkling stream in
the middle of nowhere. An afternoon of soul-searching and revealing and the
next morning he had taken Ranma's virginity and held him as he cried out
and begged for surcease.

        Ryouga would *definitely* be honored to have that privilege again.

        Ranma gasped sharply at the slight pressure and then felt Ryouga
remove his fingers, slip them back so that one found her anus just as his
thumb stretched to rub against that deliriously wonderful spot and she
almost screamed with the pleasure of it. So hot, he wanted to explode, he
wanted to shout and the feeling of Ryouga's finger inside of him like that
was completely different when he was in girl-form, it ached more and was
tighter and it made him want to scream. Ranma began to writhe in Ryouga's
lap, a guttural little cry on his lips as the thumb rubbed just so and then
he arched his back and he *did* scream as Ryouga's mouth came down upon his
to quiet it, his finger deep, thumb soothing as he ever so gently removed
his hand.

        This orgasm was different than the ones he had as a boy -- wildly
different, in fact. It wasn't so concentrated and it spread out all over
him like a warm glow from his toes to the tips of his fingers to the roots
of his hair and he wanted it again, wanted Ryouga *now*, deep inside of
him. Ranma's fingers brushed across the material of Ryouga's shirt and
parted it with trembling touch. The warmth of his chest was brick hard like
the flesh resting so heavily beneath Ranma's thighs and she wanted to part
them and take all of him in, a feral little growl coming from her even as
she shoved the shirt away.

        Ryouga brought his hands up and gently grasped a breast with one,
leaning down and suckling the nipple tightly between his teeth to hear
Ranma moan, a shuddering sort of reaction that seemed to spread down
Ranma's spine and all through her as she pushed at Ryouga's pants, shoving
them down, down, down as much as she could before her hands rose to wrap in
the tendrils of his dark hair, pushing against his bandanna as she held him
to her chest.

        Ryouga groaned as his soft tip brushed against the velvet of
Ranma's inner thigh and again he wanted to bury himself inside of her, of
him, in all ways, fill her mouth and her cunt and his ass and every orifice
that he could find and be filled in return, to kiss and touch and fuck and
glory in the warmth of this beautiful person whom he loved. The fingers of
his right hand curled about the warmth of her cunt and he stroked ever so
gently as she moaned against him. Ryouga's hands were gentle as they pushed
her onto her back in the center of the dojo floor and came over her,
pulling at the tie that kept the red hair back and letting it spill in a
wash of crimson silk over his hands, fingers knotting in it as he lifted
her for his kiss and slid between her thighs.

        Ranma moaned loudly, the motion familiar, and wrapped both legs
tightly around Ryouga's hips, her breasts hot little spots against his
chest as he leaned down to kiss first one and then the other. His right
hand aimed his staff at her core and he came up on an elbow to look down at
her face. With one last gentle kiss, he began to thrust forward, listening
to Ranma's moans of pleasure become whimpers of pain as he parted her
petals farther, farther, and then he was there at her barrier and it was
now or nothing.

        Ranma squirmed beneath Ryouga, wild with need and yet aching,
hurting and she knew that this wasn't going to be pleasant as she reached
up both hands and tugged him down to kiss her. She felt his chest press her
breasts flat and his hips thrust forward roughly and she screamed against
him as she felt the fragile skin of her hymen burst beneath the sharp
motion. Ryouga held still deep inside of her and the feeling was completely
different, somehow, than loving Ranma-kun and they both made him breathless
with need. It was so *difficult* to retain enough control to keep from
thrusting as she writhed frantically beneath him, sobbing his name. God, it
felt so good there inside of his Ranma!

        Ranma's feelings were somewhat different than Ryouga's, to say the
least. The pain wasn't really sharp -- no, more of a stinging, burning
pain, just enough to take the edge off of the pleasure and make her bite
her lip tightly, tears stinging the lids. The wild thought that Akane had
suffered through this soundlessly amazed him as he felt the tug of Ryouga
pulling back out of him again, the motion making her whimper even as she
arched her hips for him, wanting to pleasure him despite this feeling.
Ryouga slowly thrust into Ranma again, trembling as he buried his face
between Ranma's breasts to lightly nuzzle at them. His pubic bone brushed
against that spot and Ranma couldn't help the startled yelp as pleasure
flew through her again, the stinging becoming as nothing beneath the
brushing pressure of Ryouga's hips and the light nibbling of his mouth. Her
head began to toss, knotting the silken strands of red hair as she lifted
her arms above her head and arched her back, the position of her shoulders
helping to bring her closer towards him.

        Ryouga groaned loudly, the tight wet heat almost his undoing as he
continued to move, unable to help himself. Every inch of his shaft was
caressed by Ranma's inner muscles and the feeling was so different than
making love to Ranma-kun that it was an entirely disparate world. His very
bones seemed to vibrate with this feeling that was somehow associated with
the person to whom he was making love. Ranma was *his*, his lover and
beloved...and he always would be, no matter what sex Ranma was, no matter
how angry Ryouga became or how depressed or any of a thousand other
emotions. The one thing that would always stand out was the overwhelming
love and desire for the presence of this one person. With that thought,
Ryouga became a wild man, thrusting deep inside of Ranma and moving to kiss
her mouth, full and hard, moaning against her.

        Ryouga's sudden onslaught made Ranma give a guttural cry of
pleasure as he rubbed against her more frantically, her wetness
facilitating the peculiar brushing motion. Her back arched further as she
pressed up tightly against him, pleading repetitively,
"Ohgodohgodohgodohgod...!!!" and shaking her head back and forth against
Ryouga's hands as they came up to cup the back of her head. With that,
Ranma felt that strange glowing female orgasm come over him again and he
couldn't stop the loud cry that came from him as he became still beneath
Ryouga's ceaselessly moving body.

        Ryouga felt every muscle inside of Ranma clamp down against him and
could no longer resist. With a groan, he fell against Ranma's chest and
gathered her to him, shuddering. It was moments before either could so much
as lift their heads and when Ryouga finally looked down, he leaned to press
his lips against Ranma's in a tender salute.

        "Ranma," came the soft whisper, almost against her tender,  bruised
mouth, "I love you..." That was so hard to say! So hard to say when he
loved Akane, too, and a sudden wave of sadness washed over him as he
thought that this would be all his life would be made of, the memories of
these short times with Ranma....

        Ranma gently reached up and wiped away a glittering tear with the
pad of her thumb. "Shh, shh, Ryouga-kun. Don't.. don't, it's all right..."
Her fingers cupped his face gently as he shook against her, an arm wrapped
tightly about her waist. "It's all right, Ryo-chan.... I love you, too.."

        Ryouga's face crumpled as he held Ranma tightly against him, a
flood of relief washing over him and cleansing him, making him gasp for
breath even as he moaned, "I thought I had lost you!! Oh, gods, I did,
but.. but..." he began to babble, smoothing his fingers through Ranma's
hair and braiding it, fingers working to tie the knot in the dragon's
whisker so that it wouldn't go wild when Ranma changed sex.

        Ranma giggled blearily. Who knew that Ryouga had this affinity for
words? She almost laughed out loud with joy and pleasure and then...

        ...the hot water came down in a flood and his longer legs were
tangled with Ryouga's and he was afraid to look up for fear of just who
might be holding that kettle. Ryouga had gone completely still, as well, a
look of fear and worry crossing his face.

        "Mind if I join you?" came an amused voice and Ranma couldn't
believe it when he looked up and saw Akane.

        Akane smiled down at them, limbs tangled hopelessly. The last of
her rancor seemed to dissipate in a wash at the look of fear on Ranma's
face and her laughter tinkled musically throughout the dojo. "Baka," she
giggled, "you don't think I'm going to do something to you, do you?"

        Ranma looked skeptical; Ryouga just looked incredibly, incredibly
embarrassed. It was impossible to reach his clothing all tangled up like
this!!!!

        Akane solicitously handed Ryouga his pants and barely kept her
laughter back as he struggled to get them on while Ranma sat nearby, his
legs crossed as he watched as well -- with a different sort of interest.
"C'mon," she said. "I've got something you should both see." With that, she
tossed Ranma a new shirt, turned and walked out of the dojo, leaving the
two boys to stare after her curiously.

        ********************************************************

        Gender pronouns are *SO* confusing when you're working with
Ranma!!! Argh!!!

        Err.. back to the old argument. Ranma-girl and Ranma-boy? Sexually,
technically, *what is he*? Kun-chan says he's a boy regardless of what kind
of gender-play is going on, but *I* say that Ranma is Ranma, regardless of
gender (it probably amounts to roughly the same thing, I suppose..) Dunno
about the REST of you but I'd hope that whoever loved me would love me just
as much if I were a boy as if I were a girl...Not that it's likely to be a
necessary argument, y'know, but I'd still like it ^_^

        Something else.. I use the term "fuck" somewhere up there.
Everybody has a different idea of what that word means, I suppose -- it's
probably used mostly to convey a certain lack of caring for the person with
whom one is performing; however, people who love one another do so
regularly. Actual lovemaking can't be forced -- it probably only occurs
about 5% of the time that people consummate said intimate act. (This figure
actually comes from a group of women with whom I used to have regular
meetings -- one of those pointless things one does in college when one
should really be studying ^_^ We all came to an agreement about the
regularity of the occurrence, etc, etc.) Roughly figured, people have sex
50% of the time and fuck the other 45%. In general, there's not anything
wrong with fucking. It's probably more fun than the others *evil grin*

        Why "Stone & Pearl"? Well, there's been a thread in the names, sort
of.. I love music of all kinds and, with the exception of this one, they're
all song titles. Go figure, hm? This one is a lyric, 'cause naming it
"Tears of Pearl" would have been too close to Richard Lawson's "These Tears
are Pearl" and we wouldn't want THAT, nonono. Once I thought it through,
though, "Stone & Pearl" just fit really nicely. Ryouga has an affinity for
stone with his bakaisai tenketsu (forgive the spelling.. ack...) Stone just
seemed to *suit* Ryouga. He has a strange sort of honor, but he's very
steadfast and true. Akane and pearls went together for me, as well --
pearls are very feminine, sensual, there's a luster and shine to pearl that
seems to glow from the inside out. (That almost sounds sexist, doesn't it?)
Masculine jewels are darker -- bloodstone and garnet are very masculine
stones, whereas pearl, sapphire and emerald are innately feminine for me.
It's probably got something to do with the old-fashioned Southern
upbringing or something like that...

        Ok. All done. *NOW* you just haffa wait for the next story ^_^ I
figured I'd stop here since the others aren't any longer than this,
either... I guess you guys know where I'm going with this by now....

tzigane -- who's grinnin' with alla this lemon goin' on....

        ***************************************************
        *  If I die let it be with you...                 *
        *  Hold me close while the world falls in on me.. *
        *  Whisper my name as the darkness rises...       *
        *  And I fall into the dream that never ends...   *
        *      From:"The Scarlet Letters" by Scott Urban  *
        ***************************************************





                                "Parts Unknown"

"Twist and turn where angels burn/Like fallen soldiers we will learn/What once
        was gardens/Twice removed/Love will be the death/The death of you..."
                                        Savage Garden, "Tears of Pearl"

        ***************************************************

        Silver rose and emerald green met in whorls of shimmering
brilliance at the horizon as far as the eye could stretch. The sound of
running water as it flowed around rocks that had been there for more years
than any of them could imagine was soothing, settling to nerves that had
been on edge for too many weeks, too many months.

        Ranma plopped down unceremoniously in a dewed patch of velvet soft
grass and yawned sleepily. The moon shone down, its full face smiling at
the trio that stood there on the edge of the babbling stream. Akane settled
onto the warmth of a nearby rock as Ryouga stood in-between the two
indecisively. Ryouga's breath came unsteadily as he whispered ethereally,
"It's beautiful, Akane-san..."

        "Akane," she corrected quietly. "Or Akane-chan, either one." She
smiled mysteriously. "After all, we might as well get used to it. I don't
know about you, but I think we're going to be sharing something very
precious for quite a long time."

        "You mean...?" Ryouga asked hesitantly.

        Akane gave a delicate shrug. "I don't see why not. We both love
Ranma and he can't make up his mind which of us he loves more.. or even if
he loves either of us less equally."

        Ranma felt a vague sense of dissatisfaction with being talked about
as if he wasn't present but, by the grace of the kami, he managed to keep
his mouth shut.

        Ryouga gave a shy smile, his dark lashes brushing against his
cheeks with sudden serenity as he gave a long pent-up sigh of relief and
smiled at Akane with a brilliance that almost made Ranma jealous. "I'm glad
you're going to be reasonable about this..."

        Akane wrinkled her nose cutely. "Someone had to be. Besides... he
loves *both* of us... It's not really like the other fiancees..." Akane
glanced at Ranma, Ryouga's eyes following hers.

        Ranma flushed as they both looked at him. Akane's look was one of
predation, as if she was hungry for him; Ryouga's was full of a strange
tenderness, one that he hadn't seen in long years. He watched nervously as
a glance passed between them, laying back to watch the sky as stars began
to come out, twinkling and shining above him. It always surprised him that
you could see stars so near to the edges of Tokyo. They weren't all THAT
far from the dojo, and it was difficult to see them there, sometimes.

        Ranma closed his eyes as the evening breeze brushed against him,
caressing his arms and his face, lightly blowing the hair away from his
face...and then he felt them, one on either side, warmth where before there
was none.

        It started slowly -- the touch of a hand here, the caress of lips
there. Akane curled into Ranma, facing him and kissing him thoroughly,
taking the time to explore the shape of his mouth and the touch of his
tongue and the way that his teeth fit just so. It made him shudder as she
lifted one of her small hands and laid it against his diaphragm at the same
moment that Ryouga cupped his larger frame to spoon against Ranma's back,
one of his large hands settling lightly against Ranma's hips. A sudden
vision of the three of them tied into pretzel-like knots ran through
Ranma's imagination and he was highly tempted to laugh but he managed to
hold it back as Ryouga's mouth settled hot and wet against the back of his
neck. Ranma's mouth came open in a soundless gasp of pleasure, his back
arching and giving Akane the opportunity to lean forward and take his
throat with her own kisses.

        Ranma felt as if he would explode, fall apart into thousands of
shards of ecstasy as the two kissed, hands not moving, only their mouths
touching him. He could see the heat in Akane's eyes as she lifted her head
and lightly pressed her soft, swollen mouth against his own, could feel
Ryouga as he leaned over his shoulder and captured Akane's mouth with his
own, brushing a kiss across Ranma's cheek tenderly. Akane's fingers went to
the soft ties and buttons holding Ranma's blue shirt together, the material
a perfect match for his eyes. As Akane slipped the buttons from their
moorings, Ryouga slowly pulled his arms back behind him, sliding the
material over them until his chest was bare.

        Ranma missed Ryouga's touch for a moment and then it was back, bare
against him and he saw from Akane's appreciative glance that Ryouga's chest
wasn't the only thing that he had bared. Ranma felt Ryouga's arms wrap
within his own again, pulling them back and leaving him open as he arched
back against Ryouga with a low groan, the heat of the Lost Boy's chest
transferring to his own smoothly muscled back as Akane pulled her soft
cotton t-shirt over her head to toss it into the nearby heap, reaching
behind her to tug apart the hooks and eyes holding her bra together. She
came back to press against Ranma, one of her hands placed tenderly atop the
one that Ryouga had replaced on his hip.

        Ryouga's lips seemed to roam all across his shoulders and upper
arms as Akane began to nuzzle gently at his chest, her tongue flickering
across the sensitive kernels of his nipples. The keening whimper Ranma gave
caused shudders to run through all three as he arched his hips forward to
press against the material of Akane's jeans. He could feel Ryouga pressing
against his buttocks, the rigid feeling of the velvety shaft pressing just
against the place where Ranma's thighs met, nudging gently at Ranma's
testes through the soft material of the black pants that rested lightly on
his hips. Akane reached her hand around Ranma's waist, leaning up to give
him a kiss that made his head spin even as she grasped Ryouga's shaft and
made him moan loudly in Ranma's ear.

        Each movement was like a dance, limbs tangling and coming loose,
fingers searching, probing, finding, tickling and soothing, palms warm in
the cool evening air. Before long, all three were bare to the moon's glory,
bodies slick with sweat as they pressed tightly together.

        Ryouga felt an irresistible desire to reach up and pull that dragon
whisker loose from Ranma's hair again, to feel it spill in silken wash over
his fingers and hands; somehow, he resisted that hunger and reached instead
to cup Akane's head in his palm as she kissed her way down Ranma's firm
belly, her fingers wrapping around his shaft as she began to suckle him
tightly. Ranma's hand reached behind him to grasp Ryouga's cock, stroking
in time with the motions of Akane's mouth even as he shuddered with the
pleasure her touch brought him. Ryouga pulled his hand from Akane's hair
and reached to part Ranma's buttocks, Ranma helping by lifting his thigh
and settling it across Akane's waist. Ranma moaned loudly as Ryouga's
fingers teased gently at the hole he found there, playing lightly for a
moment before he invaded Ranma's body, listening to him hiss with the
pleasure-pain of the feeling. Ryouga felt something swell and burst inside
of him, all of his anger and depression welling up and overflowing and
disappearing beneath the onslaught of this unrivaled experience and then he
felt it -- Akane's hands reaching between Ranma's open thighs and pressing
against his own, opening to lightly cup him. Ryouga whimpered loudly and
pulled away from Akane's hands, unable to bear the extremity of the
pleasure as he gasped to catch his breath, his fingers brushing inside of
Ranma just right. He could almost feel the moment that Ranma exploded
inside of Akane's mouth, could hear his moans of pleasure as he went limp,
leaving both of them unsatisfied in their need for him.

        Ryouga smiled demurely as he pushed Ranma onto his back and pulled
Akane up so that they were both kneeling just over Ranma's head. He began
to kiss her, his lips tender and sweet as his hands roamed across her
breasts, listening to her moan as she arched her back and let her own hands
caress his pectorals. Ryouga allowed his left hand to brush down the curve
of her waist; he had always known that Akane would be this ethereal
creature, beauty and light and wonder all wrapped up in one package. The
similarities between the feelings that he had for Ranma and the feelings he
had for Akane made him shudder with need for them both.

        Ranma glanced up, slight jealousy filling his soul before he
shrugged it away. If *they* weren't going to behave badly, neither was
*he*. With lightly probing fingers, he began to stroke the little nubbin of
Akane's clitoris, making her moan and sway audibly above him. It was quite
a surprise to Ranma when she sort of.. collapsed right there above him,
bringing her within distance of his tongue. Any of a thousand thoughts flit
through his mind -- most of them concerning rumors involving tuna -- but
his curiosity got the better of him and, just as Ryouga's questing fingers
nudged against the spot his own had touched but moments before, Ranma's
tongue flickered to taste the dew of her honeyed flesh.

        Chills shot down Akane's spine and her cry was born of love and
passion and something that escaped her thoughts at that particular moment.
Ryouga held her as she shuddered against him, sobbing his name and Ranma's
in soft breaths and gasps. She opened her eyes and they were both there,
such handsome young men, and the realization ran through her that they were
*hers* and it made her even hotter.

        Ryouga could feel his nerves balancing finely on edge, his chi at a
fever pitch, as if all of the sexual tension could be poured straight into
an attack. After all this time, his mind seemed to flow directly into
battle innovations even now -- he almost laughed at himself. He closed his
chocolate dark eyes for a moment and when he opened them again, he could
see the pleading look on Ranma's face, the look of need, as if Ryouga
hadn't already tumbled him once today.

        Akane leaned forward and captured Ryouga's rod in her mouth, hot
and wet and Ryouga knew why Ranma couldn't resist the desire to come when
she did this to him; it sent tremors quivering across his skin. Ryouga
moaned loudly and then she removed her mouth and Ranma was there before
him, his lips warm against Ryouga's. Akane touched Ranma's shoulder and he
turned and knelt between her thighs, slowly moving down so that his hips
were pressed lightly to hers, on the verge of entrance.

        With careful motions, Ryouga moved up behind Ranma, a hand on his
shoulder, careful not to squish him into Akane as he searched for just the
right spot. He heard Ranma's loud groan as he found it, pressing until he
felt the tight ring of Ranma's anus close around the mushroom head of his
shaft. Beneath Ranma, Ryouga could hear Akane giving soft whimpers of
pleasure as his weight brought Ranma's own heaviness to bear against her,
Ranma's shaft burying slowly inside of her even as his own was burying deep
inside of Ranma. Ryouga's hand brushed past Ranma's cheek to gently caress
Akane's pleasure-filled face, a shudder moving through his soul as he
pushed slowly until he was seated completely inside of Ranma.

        Akane whimpered, looking up at both of them. This was so erotic,
the weight of them both pressed against her, Ranma's hands caressing her
breasts, Ryouga's lightly touching her face, Ranma's body pressing against
her clit and making her shudder. The look on Ranma's face was intense, full
of the most fabulous exultation she had ever seen there; a look so full of
raw passion as he moaned above her and buried his face in her throat to sob
with it that she was filled with tenderness, bringing her hands up to
stroke his shoulders gently, rocking with him in motion to Ryouga's
thrusts.

        Ranma felt as if he would fly apart at any moment. Clumsily at
first, he thrust back to Ryouga's own plunging hips, pressing forward into
Akane with motions that weren't quite right. It took them a few moments to
settle the rhythm but once they did, they soared, bodies chasing  as if
they were kites flying through the afternoon sky.

        Akane found fulfillment first, the light brushing motions
intensified by the heavier motions and her face glowed like the setting
sun, her voice loud as she cried out their names and broke the frangible
silence of the glade, her muscles clamping down around Ranma, making him
shudder and cry out. Ranma pressed deeply inside of her, giving a strangled
groan against her chest as he plunged inside of her the final time, sobbing
as Ryouga continued to thrust, his body becoming hypersensitive. Finally,
Ryouga groaned and stiffened behind him, shuddering as he filled Ranma with
liquid heat and tumbled down into the pile of sweaty limbs and flesh.

        It was a long time before any of them spoke and when someone did,
it was a single word from Ranma. "P..p..pretzel..."

        And laughter filled the moondrenched clearing.

        **********************************************************

        The screams were deafening, threats from the one, soothings from
the other.

        "WHERE IS HE, YOU BASTARD!?! WHAT HAVE YOU DONE WITH MY BAAABY!!!"
The screams fell off into low sobs as Ranma's father paced back and forth
frantically, trying to come up with some kind of answers to his wife's
demands. He could hear her chanting to herself behind him, "N..never should
have let you have my *baby*... I.. I knew, knew what kind of, of.. of
PERSON you are and..." the sobs intensified, "and I *LET YOU TAKE MY
BABY*!!!!! I should *KILL* you, you miserable son of a bitch!!!" she
screamed at him.

        What little patience Genma had wore thin and he reached out to
shake his wife roughly. "Your *baby* is some kind of weird fucked up little
yaoi boy, Nodoka. Don't keep thinking that he's a baby anymore. No, he's a
travesty, nothing like what I brought him up to be and you wanted him to
be! I will *not* commit seppuku! I fulfulled my promise -- I brought him up
to be a man!! Bah! He's as easily corruptible and weak-minded as you are!"
His hand flew across her cheek roughly and she fell at his feet in a
miserable, sobbing heap.

        **********************************************************

        Ranma watched it all from the dojo roof -- every motion of this
twisted play was clear to him now. His mother loved him, oh, yes... loved
him so much that she sent him away with that twisted asshole who was his
father simply to get Genma out of her life. Tears gathered in his eyes but
he restrained them manfully as he watched his mother sob after his father
stormed out of the room, her katana cradled lovingly in her arms. He had a
feeling that he knew what she would want to use it for. Ranma sighed softly
and then he felt them, first one and then the other, settling down warmly
against him. Akane's voice shivered in the air, "I'm so sorry, Ranma..."
Ryouga's hand simply went to Ranma's shoulder in a gesture of comfort.

        Ranma lowered his head and looked at his shoes. He had.. had never
known things were this way. Looking up, he announced, "I'm leaving."

        Ryouga and Akane looked at one another worriedly.

        **********************************************************

        The sky was streaked with fingers of salmon, clouds of sapphire
shimmering above the dojo as the trio of shadows walked away from the
building slowly. On the table lay a note, explaining why they were leaving
and telling their families that when they were willing to accept all three,
they would be willing to return. One of the shadows had thought this was
the cowardly way out, but the other two were more worried about his health
than his pride.

        With the sun rising blood-red and orange in the morning sky, they
left their small Nerima and went out into the wide, wide world.

        **********************************************************

        That's it! I'm done! You can all fall at my feet and worship me
now... I won't mind one bit. ^_~ Well, then, I've done what I set out to do
-- instead of Ranma the homosexual or Ranma the fanatically straight guy,
we now have Ranma the bisexual... well... more or less. This was *not*
easy. Well, it was probably easier to write than my first fanfic *shudders
in horror* Waii. Well, it wasn't all THAT bad.. just sort of obscure..
*scratches head* Back to the subject. Hrmm.. what WAS the subject? Oh, yeah
^_^ Shuuichi-kun and I had a discussion once about how difficult it might
be to write a threesome. Hm. Didn't seem all THAT hard, but then... I
wouldn't want to make it look too easy, either ^_~  Now, I can go back to
work on the "Swordplay" stories.... This is the end, the last, alllll she
wrote for "Father Figure".  Hope ya liked it.

        Oh, yeah. I've started on my "Erotic Adv. of Sleeping Beauty/Ranma
1/2" crossover *evil smile* Kuno is the Prince -- Ranma is, too. *maniacal
laughter* Er.. *coughcough* Hrm. Yes. *sweet smile* Everyone is present....
Kasumi gets to smack him on his way to Kuno's kingdom of Happos...
(remember the girl who smacked Beauty in front of the window so everyone
could see?) I DON'T think I'm going to use Akane as a serious love
interest, though. Nope, it's Ryouga again.. and Mousse, too. Y'know, maybe
it's just me, but if *I* were Shampoo, I'd fall at his feet to beg *grins*
Begging being one of my favorite things to do, anyway... Right after
ice.... Ahhh, Ryouga-kun, come HERE for a moment, please.. I'm sure
Gen-chan won't mind, darling... she's off on spring break.... *evil grin*

tzigane -- who's done in... for the moment... and who'll stop babbling...
           really... I promise...



--====================987654321_0==_
Content-Type: text/plain; charset="us-ascii"

--====================987654321_0==_--